Government recommendations and mainstream media ; examples.

 NHS-Get tested for coronavirus-Covid -19 
 https://www.nhs.uk/conditions/coronavirus-covid-19/testing/get-tested-for-coronavirus/

There are different tests you can get to check if you have coronavirus (COVID-19). The test you need depends on why you're getting tested.
The 2 main tests are:
-PCR tests – mainly for people with symptoms, they're sent to a lab to be checked
- Rapid  lateral flow tests – only for people who do not have symptoms, they give a quick result using a device similar to a pregnancy test.

Public Health England -Understanding cycle threshold (Ct) in SARS-CoV-2 RT-PCR
https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/926410/Understanding_Cycle_Threshold__Ct__in_SARS-CoV-2_RT-PCR_.pdf

"A single Ct ( cycle threshold ) value in the absence of clinical context cannot be relied upon for decision making about a person’s infectivity.
Ct values cannot be directly compared between assays of different types – not all laboratories use the same assay, and some may use more than one."

"There are many different SARS-CoV-2 RT-PCR assays/platforms in use across the UK."

"The clinical significance of positive results with high Ct are difficult to interpret in the absence of clinical history and context."

"Ct values are not directly comparable between assays and may not be reported by some RT-PCR platforms in use. Interpreting single positive Ct values for staging infectious course, prognosis, infectivity or as an indicator of recovery must be done with context about the clinical history."

Lateral Flow and PCR Covid tests: What's the difference and which do you need to travel?
https://www.mirror.co.uk/news/uk-news/lateral-flow-pcr-covid-testswhats-24092049  12 May 2021

- PCR tests are often seen as the "gold standard" tests for detecting cases of Covid-19, because it requires laboratory analysis.It also boasts an accuracy rate of around 99%, and far smaller amounts of the virus can be detected than with LFTs.
However, this sensitivity does mean that people can experience having a positive result after having Covid, despite no longer being contagious.
- A Lateral Flow test is also a swap test, but rather than detecting genetic material, it detects proteins specific to coronavirus.
What is the difference between PCR and Lateral Flow tests?
One of the biggest differences is that Lateral Flow tests return results much faster – usually within 30 minutes.
PCR tests often take between 24 hours and three days to return a result.
However, PCR tests are deemed to be much more accurate than Lateral Flow tests.Public Health England (PHE) found that the sensitivity of Innova Lateral Flow test was 79.2% when administered by a trained healthcare professional.
However, it said the accuracy dropped to 57.5% when used by track and trace centre staff.
PHE did add that with regular mass testing several times a week, this should improve.
If you do get a positive Lateral Flow test, you are asked to get a PCR test to confirm your result.

Has Sars-CovV-2 been isolated ? What is the PCR test  and what are they testing for?
What does the Independent Science and Evidence say as opposed to following unmentioned experts and following ' science' as if it was a religion ?

Background:

PCR test

Dr. Kary Banks Mullis Explains How PCR Testing Can Be Misrepresented To Show a Positive Test-  https://m.youtube.com/watch?v=VW5bNd-D0jw

Dr Kary Mullis: " With a PCR,  if you do it well, you can find anything in anybody".

Dr. Stefan Lanka - PCR Test (20 Dec 2020) https://www.medicdebate.org/node/2224
Dr Stefan Lanka:
- If the conditions are not stringent you produce any kind of genetic material even without having genetic material present a long knows fact with PCR test.
-Therefore, you can test anything and anybody even the most pure water or vodka.
--It is just adjusted to give a general rate of positivity and , then, it does not matter. Sure if there is some genetic material ie some nucleotides   inside it easily gives a positivity.
-General limitation: If the temperature, the conditions ( concentration, constitution )of the primer , if they are not absolutely correct the testing done is far away from any biochemical reason.
-You can use PCR test in a precise way , up to  20 cycle you get very clean result but in more it becomes  unclear and very dirty.
-The number of cycles- how often you repeat a multiplication process polymerase( a polymerase chain reaction) can be meaningful up to 30 cycles.
- They are using 45 cycles, completely out of reason because there are no primers present anymore because they are used up already. So this technique,logically, on a mathematical base cannot work anymore .

Correlation Between 3790 Quantitative Polymerase Chain Reaction–Positives Samples and Positive Cell Cultures, Including 1941 Severe Acute Respiratory Syndrome Coronavirus 2 Isolates
https://academic.oup.com/cid/article/72/11/e921/5912603,     28 September 2020

" in an article published in Clinical Infectious Diseases, Bullard et al reported that patients could not be contagious with Ct >25 as the virus is not detected in culture above this value [6]. This limit was then evoked in the French media during an interview with a member of the French Scientific Council Covid-19 as a possible value above which patients are no longer contagious."

"It can be observed that at Ct = 25, up to 70% of patients remain positive in culture and that at Ct = 30 this value drops to 20%. At Ct = 35, the value we used to report a positive result for PCR, <3% of cultures are positive."

'Virus 'Isolation

Statement On Virus Isolation (SOVI)
https://andrewkaufmanmd.com/sovi/

German Investigative Journalists Still Searching for Proof that Sars-CoV-2 Exists-February 3, 2021
(https://vaccineimpact.com/2021/german-investigative-journalists-still-searching-for-proof-that-sars-cov-2-exists/

1,5 million € for a virologist who presents scientific proof of the existence of a corona virus-
https://rightsfreedoms.wordpress.com/2021/06/25/15-million-e-for-a-virologist-who-presents-scientific-proof-of-the-existence-of-a-corona-virus/

The following article addresses the scientific evidence :
Has  any human coronavirus ever been isolated and what are they testing for?

The scam has been confirmed: PCR does not detect SARS-CoV-2
Number 242 - November 2020 Reading time: 15 minutes
(http://philosophers-stone.info/wp-content/uploads/2020/11/The-scam-has-been-confirmed-Dsalud-November-2020.pdf)

"Have any human coronaviruses been isolated?"

 "“the alleged isolation work of suspected human coronaviruses 229E (said to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in 2005) and MERSCoV (in 2012).”

 "In essence, NOT ONE OF THE SEVEN SUPPOSED HUMAN CORONAVIRUS HAS REALLY BEEN ISOLATED. The only thing that has been different between them are the laboratory procedures and techniques that were becoming progressively more sophisticated which, in this case, has implied not a greater accuracy but a greater capacity for deception and self-deception that has culminated in the virtual manufacture of the SARS-CoV-2.

And the obvious consequence of the lack of evidence of its isolation is that such "coronaviruses" cannot be held responsible for any disease. Moreover, all tests - of whatever kind - based on the presumed components of these "viruses" (nucleic acids or proteins) are completely disqualified as "infection tests" and even more as "diagnostics" of diseases."

LOOKING FOR THE ORIGIN OF THE FALSE GENOME
The question we asked ourselves then was: if the sequences that have been published do not belong - as claimed- to new viruses, where do they come from? And to try to answer that question we decided to carry out a search with a computer program called Basic Local Alignment Search Tool (BLAST), a sequence alignment search tool that allows us to compare a given sequence with all the sequences stored in the National Institutes of Health of the United States (it is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by step what we did so that our readers can repeat the search for themselves and check the results.
First we collected all the initiators of the PCRs described in the protocols hosted on the WHO website at the time which were these:
- China CDC protocol: uses ORF1ab and N genes as target.
- Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to
be SARS.CoV-2 specific).
- United States CDC protocol: uses three fragments of the N gene.
- Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as target the S gene together with other genes supposedly shared with other coronaviruses.
- Charite Protocol (Germany): uses the E, N and RdRP genes.
- Hong Kong University Protocol: uses ORF1b-nsp14 and N gene. - National Institute of Health Thailand protocol: uses the N gene.
We then introduced the sequence of the primers - the one that indicates the beginning of the sequence to be detected (forward) and the one that indicates the final (reverse) - into the BLAST so that it could search for them in two databases:  a collection of microbe genomes and the one corresponding to the human .

THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN HUMANS AND IN NUMEROUS MICROBES!
Let's see in detail the procedure taking as an example the initiators of the French protocol. Once on the BLAST website, we chose Microbes to search the microbial genome databases and moved to the next page. Then a form appeared in which we entered the sequence of the forward initiator of the French protocol -that is ATGAGCTTAGTCCTGTG-, we selected the option Highly similar sequences and pressed the BLAST key. Just a few seconds later the results appeared -we took a screenshot (image 1)- and we were shown 100 sequences of microbes -particularly bacteria and archaea- with a coincidence of between 77% and 100% with an identity percentage of 100%.
We then returned to the home page and that second time we chose Human to search the human genome, we repeated the same operation and after a few seconds the result appeared which we
screen captured again (image 2). And it turns out that the sequence entered coincides with 74 sequences of the human genome, with a coincidence of between 66% and 100% and a percentage of identity of 100%.
And that indicates that the sequence of that initial PCR primer that is supposed to be specific to SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred microbial fragments as well!
We then decided to repeat the operation but with the final or reverse primer - which is CTCCCTTTGTGTGTGT - and the results were similar.
Since these were very short sequences -about twenty genetic letters or nucleotides- we decided to try again but with the target sequence defined by these two primers, i.e. the sequence of the supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously, for this we needed the sequence that is officially claimed to be the "SARS-CoV-2 genome" and although thousands of laboratories claim to have isolated and sequenced it -a false claim as we have explained in previous reports- we decided to go to the National Centre for Biotechnology Information website: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2? report=genbank&to=29903. Once there, we located the "target sequence", a fragment of 108 nucleotides located between positions 12,690 and 12,797 of the "genome", which is this one:

ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG.
With this we repeated the steps previously described and the results were again surprising since there appeared again a hundred microbe sequences with a percentage of a match of 100% and four sequences of the human genome with an identity percentage between 83% and 95%. The matches were therefore lower but the important thing is that we continue to find fragments of the supposed "target sequence" of SARS-CoV-2 both in microbes and in our own genome.
Truly astonished we took a further step and tested with the gene considered at that time as the most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472: ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCT TTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTG TTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA.
We repeated with it the steps already described and the result was even more surprising because despite its length another hundred microbe sequences appeared with a percentage of identity of 100% and 10 sequences of the human genome with a percentage of identity between 80% and 100%. And similar results were obtained with a fragment chosen at random and with the N gene which they say corresponds to the proteins of the SARS-CoV-2 nucleocapsid.
We finally decided to test with the S gene which is said to generate the structural "spike" proteins that are key to entry into the cell and was subsequently considered to be the most specific SARS- CoV-2 gene. Since it is a gene whose sequence is much longer - 3821 nucleotides between positions 21,563 and 25,384 - we tested with two fragments chosen at random within that gene and the first - TTGGCAAAATTCAAGACTCACTTTC - resulted in another hundred microbe sequences and 93 sequences of the human genome and the second - CTTGCTGCTACTAAATGCAGAGTGT - a hundred microbial sequences and 90 of the human genome.

Finally we decided to test with the initiators of the Japan Protocol, the only one that includes target sequences of the S gene and, the reader will have already guessed, the results were once
again similar: a hundred microbe sequences and 93 sequences of the human genome with an identity percentage between 94.12% and 100%!

CONCLUSIONS
The consequence of all that we have just explained is clear and immediate:THERE IS NO VALID TEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included those based on the supposed gene that codes for the S1 or spike protein. And that means that ALL THE NUMBERS OF "CASES", "INFECTED", “SICK", "Asymptomatic" OR "DEAD DUE TO COVID-19" LACK A SCIENTIFIC BASE AND ALL “POSITIVES” ARE FALSE POSITIVES, something that should be communicated immediately to those affected and those responsible should be held accountable.